The molecular mechanisms underlying the regeneration process in the earthworm, Perionyx excavatus exhibit indications of apoptosis-induced compensatory proliferation (AICP).

Regeneration is a multifaceted biological phenomenon that necessitates the intricate orchestration of apoptosis, stem cells, and immune responses, culminating in the regulation of apoptosis-induced compensatory proliferation (AICP). The AICP context of research is observed in many animal models like in Hydra, Xenopus, newt, Drosophila, and mouse but so far not reported in earthworm. The earthworm Perionyx excavatus is used in the present study to understand the relationship between AICP-related protein expression and regeneration success in different conditions (normal regeneration and abnormal multiple bud formation). Initially, the worms are amputated into five equal portions and it is revealed that regeneration in P. excavatus is clitellum independent and it gives more preference for anterior regeneration (regrowth of head portion) than for posterior regeneration (regrowth of tail portion). The posterior segments of the worm possess enormous regeneration ability but this is lacking in anterior segments. Alkaline phosphate, a stem cell marker, shows strong signals throughout all the posterior segments but it decreases in the initial 1st to 15th anterior segments which lack the regeneration ability. While regenerating normally, it was suggested that the worm follow AICP principles. This is because there was increased expression of apoptosis signals throughout the regeneration process along with constant expression of stem cell proliferation response together with cellular proliferation. In amputated posterior segments maintained in vitro, the apoptosis signals were extensively detected on the 1st day. However, on the 4th and 6th days, caspase-3 and H2AX expression are significantly suppressed, which may eventually alter the Wnt3a and histone H3 patterns that impair the AICP and result in multiple bud formation. Our results suggest that AICP-related protein expression pattern is crucial for initiating proper regeneration.

Understanding the process of angiogenesis in regenerating earthworm.

Developing blood vessels from the existing vasculature is vital for the growth of the organism, as well as for systematic wound healing and the repair process. In this study, we investigated the role of angiogenesis during the regeneration process in the earthworm, Eudrilus eugeniae, animal model. Briefly, the morphological examination of blood vessels in juvenile and mature worms is documented, along with the development of new blood vessels in regenerating blastema. However, in vivo and in vitro experiments with juvenile worms revealed that geraniol retards blastemal regeneration growth with undeveloped blood vessels, as compared to the control. The results of qRT-PCR, western blotting, and immunohistochemistry confirmed a reduced expression of VEGFR2 and WNT5A in the day 3 regenerating blastema of geraniol-treated worms, as compared to the control. We conclude that geraniol acts as a potent natural inhibitor of angiogenesis, thereby retarding the regeneration process in earthworms. In addition, for studying angiogenesis and screening effective angiogenesis inhibitors as drug candidates, the earthworm is an ambient animal model system.

Comparative analysis of the survival and regeneration potential of juvenile and matured earthworm, Eudrilus eugeniae, upon in vivo and in vitro maintenance.

Eudrilus eugeniae is a clitellum-dependent earthworm that requires intact clitellum segments for its survival and regeneration. The present study aims to interconnect the survival and regeneration ability that varies between in vivo and in vitro maintenance upon different sites of amputation. The amputated portion of the worm that possesses intact clitellum (13th-18th segments) survived and had the potential to regenerate, whereas worms with partial or without clitellum segments only survived and were unable to regenerate. Besides segment length and clitellum segments, clitellum factors also determined the survival, blastemal initiation and differentiation potential. The survivability and regeneration potential of worms were augmented upon in vitro maintenance. Notably, the amputated segments (1st-10th segments) and posterior segments of similar length, which usually die within the 4th day in vivo, survived for more than 60 days in vitro but lacked the regeneration ability. On the other hand, the amputated posterior segments (30th to 37th segments) from juvenile worms, maintained in in vitro condition, survived and initiated blastema with multiple buds but lacked the ability to regenerate. Interestingly, the equal half of adult worm blastema that is maintained in in vitro conditions were able to form the blastema-like structure with the help of a unique stick. The anterior blastema failed to retain the regenerative structure but the posterior portion of the amputated blastema, which is also associated with a small portion of the body segment, showed the ability to retain the regenerative structure. Our results conclude that the survivability is enhanced upon in vitro maintenance and this condition favours the adult dedifferentiated blastemal and stem cell-enriched juvenile posterior segments to form a regenerative blastema.

The emerging role of selenium metabolic pathways in cancer: New therapeutic targets for cancer.

Selenium (Se) is incorporated into the body via the selenocysteine (Sec) biosynthesis pathway, which is critical in the synthesis of selenoproteins, such as glutathione peroxidases and thioredoxin reductases. Selenoproteins, which play a key role in several biological processes, including ferroptosis, drug resistance, endoplasmic reticulum stress, and epigenetic processes, are guided by Se uptake. In this review, we critically analyze the molecular mechanisms of Se metabolism and its potential as a therapeutic target for cancer. Sec insertion sequence binding protein 2 (SECISBP2), which is a positive regulator for the expression of selenoproteins, would be a novel prognostic predictor and an alternate target for cancer. We highlight strategies that attempt to develop a novel Se metabolism-based approach to uncover a new metabolic drug target for cancer therapy. Moreover, we expect extensive clinical use of SECISBP2 as a specific biomarker in cancer therapy in the near future. Of note, scientists face additional challenges in conducting successful research, including investigations on anticancer peptides to target SECISBP2 intracellular protein.

Finding of novel telomeric repeats and their distribution in the human genome.

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.